Green turtle mtDNA sequences

To facilitate haplotype designations and avoid confusion among ocean basins, we are using the nomenclature of CMP# for the Pacific. Check also sequences posted for the Atlantic on the Archie Carr Center websiteThe previous link is a link to Non-Federal government web site. Click to review NOAA Fisheries disclaimer.

Turtle-dna-logo.jpgIf you have a new sequence from the Pacific or Indian Ocean please email it to Peter.Dutton@noaa.govand we will confirm the status of the sequence and assign a new sequence designation number. Sequences will not be posted on the website until the researcher who is the source of the new sequence gives permission.

It is the responsibility of the author of the new sequence to submit their sequence to GENBANK ( http://www.ncbi.nlm.nih.gov).

The table below summarizes the named haplotypes for Pacific and Indian Ocean green turtles with GENBANK Accession numbers and references. Contributed sequences are variable lengths, but haplotypes listed here are based on alignment with the 384bp fragment as first reported in Norman et al. (1994).

CM sequence designation

Other name(s)

GenBank Accession Number

Reference

CmP1

D6

AY540055

Dutton et al. Unpublished

CmP2

HAPC

AY540056

Dutton et al. Unpublished

CmP3

HAPD

AY540057

Dutton et al. Unpublished

CmP4

D4

AY382323

Dutton et al. Unpublished

CmP5

 

AY382324

Dutton et al. Unpublished

CmP7

HAPH

AY382325

Dutton et al. Unpublished

CmP8

HAPI

AY382326

Dutton et al. Unpublished

CmP9

 

AY540058

Dutton et al. Unpublished

CmP10

 

AY540059

Dutton et al. Unpublished

CmP11

 

AY540060

Dutton et al. Unpublished

CmP12

HAPM

AY382327

Dutton et al. Unpublished

CmP13

 

AY540061

Dutton et al. Unpublished

CmP14

 

AY540062

Dutton et al. Unpublished

CmP15

 

AY540063

Dutton et al. Unpublished

CmP16

 

AY540064

Dutton et al. Unpublished

CmP17

 

AY540065

Dutton et al. Unpublished

CmP18

CMTWA

AY540066

Dutton et al. Unpublished

CmP19

CMTWC

AY540067

Dutton et al. Unpublished

CmP20

A3

AY540068

Dutton et al. Unpublished

CmP21

 

AY540069

Dutton et al. Unpublished

CmP22

FIJC

AY540070

Dutton et al. Unpublished

CmP23

FPA

NA

Norman et al. 1994

CmP24

 

AY540071

Dutton et al. Unpublished

CmP30

FIJD

NA

Dutton et al. Unpublished

CmP31

FIJE

NA

Dutton et al. Unpublished

CmP32

FIJF

NA

Dutton et al. Unpublished

CmP33

FIJG

NA

Dutton et al. Unpublished

CmP34

FIJH

NA

Dutton et al. Unpublished

CmP35

FPB

NA

Norman et al. 1994

CmP36

GOC, JVAa

NA

Norman et al. 1994

CmP37

JPNA

NA

Norman et al. 1994

CmP38

JPNB

NA

Norman et al. 1994

CmP39

JPNC

NA

Dutton et al. Unpublished

CmP40

JPND, C5

AY955209

Dethmers et al

CmP42

JVAb

NA

Norman et al. 1994

CmP43

LAC

NA

Norman et al. 1994

CmP44

NCBR, B1

NA

Norman et al. 1994

CmP45

NWC

NA

Norman et al. 1994

CmP46

PNG

NA

Norman et al. 1994

CmP47

SGBR, A2

NA

Norman et al. 1994

CmP48

SWK

NA

Norman et al. 1994

CmP49

TIN, C3, Ind1

AY955204

Dethmers et al. 2006

CmP50

TWD, No. 10 Zamami

NA

Dutton et al. Unpublished

CmP51

TWE

NA

Dutton et al. Unpublished

CmP52

No. 33 Zamami

NA

Tanaka, Unpublished

CmP53

 

NA

Dutton et al. Unpublished

CmP55

 

NA

Dutton et al. Unpublished

CmP56

 

NA

Dutton et al. Unpublished

CmP57

D2, Ind2

AY955205

Dethmers et al. 2006

CmP59

D5

U40659

Dutton et al. 1996

CmP60

E1a

AY955217

Dethmers et al. 2006

CmP61

E2a

AY955216

Dethmers et al. 2006

CmP62

H1, CMOM3

AJ831526

Alansari Unpublished

CmP63

H2

NA

D. Broderick, Unpublished

CmP64

H3

NA

D. Broderick, Unpublished

CmP65

I

NA

D. Broderick, Unpublished

CmP66

J1

AY955198

Dethmers et al. 2006

CmP67

J14212, A6

AY955221

Dethmers et al. 2006

CmP68

J2

AY955199

Dethmers et al. 2006

CmP69

JpnE

NA

Dutton et al. Unpublished

CmP70

JpnF

NA

Dutton et al. Unpublished

CmP71

L1, CMOM4

AJ831527

Alansari Unpublished

CmP72

L2, CMOM2

AJ831525

Alansari Unpublished

CmP73

M, CMOM1

AJ831524

Alansari Unpublished

CmP74

 

U40436

Dutton et al. 1996

CmP75

Ind3

AF529030

Formia et al. 2006

CmP76

A1

AY955215

Dethmers et al. 2006

CmP77

A4

AY955220

Dethmers et al. 2006

CmP78

A5

NA

D. Broderick, Unpublished

CmP79

B2

NA

D. Broderick, Unpublished

CmP80

B3

AY955214

Dethmers et al. 2006

CmP81

B4

AY955213

Dethmers et al. 2006

CmP82

B5

AY955200

Dethmers et al. 2006

CmP83

C1

AY955201

Dethmers et al. 2006

CmP84

C12

AY955211

Dethmers et al. 2006

CmP85

C13

AY955212

Dethmers et al. 2006

CmP86

C2

AY955203

Dethmers et al. 2006

CmP87

C4

AY955207

Dethmers et al. 2006

CmP88

C7

AY955210

Dethmers et al. 2006

CmP89

C8

AY955208

Dethmers et al. 2006

CmP90

C9

AY955202

Dethmers et al. 2006

CmP91

Caru, C14

AY955206

Dethmers et al. 2006

CmP92

 

NA

Dutton et al. Unpublshed

CmP93

 

NA

Dutton et al. Unpublshed

CmP94

 

NA

Dutton et al. Unpublshed

CmP95

 

NA

Dutton et al. Unpublshed

CmP96

 

NA

Dutton et al. Unpublshed

CmP97

 

NA

Dutton et al. Unpublshed

CmP98

 

NA

Dutton et al. Unpublshed

  To the top

References

Dethmers KEM, Broderick D, Moritz C, Fitzsimmons NN, Limpus CJ, Lavery S, Whiting S, Guinea M, Prince RIT, Kennett R (2006) The genetic structure of Australasian green turtles (Chelonia mydas): exploring the geographical scale of genetic exchange. Molecular Ecology 15:3931-3946

Formia A, Godley BJ, Dontaine J-F, Bruford MW (2006) Mitochondrial DNA diversity and phylogeography of endangered green turtle (Chelonia mydas) populations in Africa. Conservation Genetics 7:353-369

Norman JA, Moritz C, Limpus CJ (1994) Mitochondrial DNA control region polymorphisms: genetic markers for ecological studies of marine turtles. Molecular Ecology 3:363-373

  To the top

CmP1

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP10

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTACTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTGTAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP11

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTGTAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP12

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTACAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP13

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATGGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

Cmp14

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGACAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTGTAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP15

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGGATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP16

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAATTTGTAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP17

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAACGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP18

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAGTAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAACGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP19

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP2

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATACCT-GATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP20

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP21

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP22

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

TACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP24

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAATTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP3

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP30

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTGAATTCACATAAA-TATTTTAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTGA

CGTTCATTCGTTCCcCTTTAAAAGGCCTTTGGTGAAtT----------GAgTTCTATAC----------------

  To the top

CmP31

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATTTGCATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACGGTAATTGGTTATTTCTTAAATAACTATTCACGAGAAATAAGCAACCCTTGTTGGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAN

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAtT---------GAgTTCTATACATTA------------

  To the top

CmP32

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGACGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP33

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAGAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATCTGATCTATTCTGGCCTCTGGTTGTTCCTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTAT-----

  To the top

CmP34

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATCTGATCTATTCTGGCCTCTGGTTGTTCCTTCAGGCACATATAAATAACGA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP35

TAGCATATGACCAGTAATGTTAACGGTTGATTTGGCCCTAAACATAAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

TACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP36

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATAAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP37

TAGCATATGACCAGTAATGTTAACGGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTGCATAAAATATTTTAATAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP38

TAGCATATGACCAGTAATGTTAACGGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP39

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTGCATAAAATATTTTAATAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP4

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP40

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP42

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTCACATAAA-TATTTTAATAA

CATAAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP43

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATAAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACGGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP44

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATTTGCATAAA-TGTTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

TACGGTAATTGGTTATTTCTTAAATAACTATTCACGAGAAATAAGCAACCCTTGTTGGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP45

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATAAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACGGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAGCCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP46

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACGGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP47

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATCTGATCTATTCTGGCCTCTGGTTGTTCCTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP48

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAACAA

CATAAATGTTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP49

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP5

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGCAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP50

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATGTTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP51

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTACATAAAATATTTTAATAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGCAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP53

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTTCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP54

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP55

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP56

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTGAATTCACATAAA-TATTTCAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAATCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAATTTGTAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP57

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAGTAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP59

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACCCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAACTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP6

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTGTAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP60

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGCCTTTGGTTGGATGAGTTCTATAC----------------

  To the top

CmP61

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGCCTTTGGTTGAATGAGTTCTATACATTAGATTTATAACCT

  To the top

CmP62

TAGCATATGACCAGTAATGTCAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP66

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTCACATAAA-TATTTTAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACGGTAATTGGTTATTTCCTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGACGTACATAATCTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP67

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP68

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTCACATAAA-TATTTTAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACGGTAATTGGTTATTTCCTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGACGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP69

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP7

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP70

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTGCATAAAATATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP71

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAACTGACATAAA-TATTTTGATAG

CATGAATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAGATAAGCAACCCTTGCTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAATTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP72

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAACTGACATAAA-TATTTTGGTAG

CATGAATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAGATAAGCAACCCTTGCTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAATTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP73

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAACTGACATAAA-TATTTTAATAG

CATGAATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAGATAAGCAACCCTTGCTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAATTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP74

TAGCATATGACCAGTAATGTTAACGGTTGATTTGGCCCTAAACATGAAAATTATTGAATTCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCCTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTA------

  To the top

CmP75

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTA------

  To the top

CmP76

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGACGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAATGA-----------TTCTATACATTAGATTTATAACCT

  To the top

CmP77

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATTTGCATAAA-CATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAATTTGTGGCGTACATAATATGATCTATTCTGGCCTCTGGTTGTTCCTTCAGGCACATATAAATAACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP8

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGGATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAATAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP80

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATTTGCATAAA-TGTTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACGGTAATTGGTTATTTCTTAAATAACTATTCACGAGAAATAAGCAACCCTTGTTGGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP81

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATTTGCATAAA-TGTTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

TACGGTAATTGGTTATTTCTTAAATAACTATTCACGAGAAATAAGCAACCCTTGTTGGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP82

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTGCATAAAATATTTTAATAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP83

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACGGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP84

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTGAATTCACATAAA-TATTTTAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAATCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP85

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTGAATTCACATAAA-TATTTTAATGG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTTTTTCAGGCACATACAAATAGTGA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP86

TAGCATATGACCAGTAACGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACGGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAGCCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP87

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAACAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP88

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGCAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP89

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAACAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP9

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGGTAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP90

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAG

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACGGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP91

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTAA

CGTCCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP92

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP93

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGCAAT--GTTGAATGAGTTCTATACATTAAATTTATAACCT

  To the top

CmP94

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGCA---GGTTGAATGAGTTCTATACATTAAATTTATAACCT

  To the top

CmP95

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATAAAAATTATTAAATTTGCATAAAATATTTTAGTAA

CATGAATATTAAGCAGAGAGTTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTCAGTTTGTGGCGTACATAACTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATACAAATAGTAA

CGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

  To the top

CmP96

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAATCCACATAAA-TATTTTGATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATCGT

CACAGTAATTGGTTATTTCTTAAGTAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAGGCCCATTTAGTTTATAGCGTACATAACCTGATCTATTCTGGCCTCTGGTTGGCTTTTCAGGCACATACAAATAACAA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGCAAT--GTTGAATGAGTTCTATACATTAAATTTATAACCT

  To the top

CmP97

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTGAGTTTACATAAA-CATTTTAATAA

CATGGATATTAAGCAGAGGATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

CACAGTAATTGGTTATTTCTTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCAGTTT

CAAGCCCATTCAGTTTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTTCTTTCAGGCACATATAAATGACGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAGATTTATAACCT

  To the top

CmP98

TAGCATATGACCAGTAATGTTAACAGTTGATTTGGCCCTAAACATGAAAATTATTAAATTTGCATAAA-TGTTTTAATAA

CATGAATATTAAGCAGAGAATTAAAAGTGAAATGATATAGGACATAAAATTAAACCATTATACTCAACCATGAATATTGT

TACGGTAATTGGTTATTTCTTAAATAACTATTCACGAGAAATAAGCAACCCTTGTTGGTAAGATACAACATTACCAGTTT

CAAGCCCATTTAGTTTATAGCGTACATAATTTGATCTATTCTGGCCTCTGGTTGTCTTTTCAGGCACATACAAATAGTGA

CGTTCATTCGTTCCTCTTTAAAAGGCCTTTGGTTGAAT----------GAGTTCTATACATTAAATTTATAACCT

Last modified: 12/24/2014